GET /pola3r/eventhierarchy/3192/
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "url": "http://www.biodiversity.aq/pola3r/eventhierarchy/3192/",
    "event_hierarchy_name": "IB03_046.40",
    "event_type": "event",
    "description": null,
    "event_creator": "Maxime Sweetlove",
    "created_on": "2020-12-17",
    "updated_on": "2020-12-17",
    "event": [
        {
            "parent_event": "IB03_046.40",
            "footprintWKT": "SRID=4326;POINT (-51.98403 -61.56175)",
            "eventRemarks": null,
            "sample_name": "IB03_046.40",
            "collection_year": 2009,
            "collection_month": 3,
            "collection_day": 18,
            "collection_time": null,
            "samplingProtocol": "CTD Rosette/Niskin bottle",
            "event_metadata": {
                "metadata_tag": null,
                "md_created_on": "2020-12-08",
                "metadata_creator": "Maxime Sweetlove",
                "license": "CC BY 4.0",
                "geographic_location": null,
                "locality": null,
                "geo_loc_name": null,
                "env_biome": "ocean biome [ENVO:01000048]",
                "env_package": "water",
                "env_feature": "ocean [ENVO:00000015]",
                "env_material": "sea water [ENVO:00002149]",
                "institutionID": null,
                "nucl_acid_amp": null,
                "nucl_acid_ext": null,
                "ref_biomaterial": null,
                "rel_to_oxygen": null,
                "rightsHolder": null,
                "samp_collect_device": null,
                "samp_store_dur": null,
                "samp_store_loc": null,
                "samp_store_temp": null,
                "samp_vol_we_dna_ext": null,
                "samplingProtocol": null,
                "source_mat_id": null,
                "submitted_to_insdc": true,
                "investigation_type": "metagenome",
                "isol_growth_condt": null,
                "lib_size": null,
                "additional_information": null
            },
            "occurrence": [
                {
                    "occurrenceID": "IB03_046.40",
                    "taxon": {
                        "name": "Bacteria",
                        "TaxonRank": "kingdom",
                        "taxonID": "urn:lsid:marinespecies.org:taxname:6",
                        "parent_taxa": null
                    },
                    "occurrence_notes": "occurrence implied by presence of genetic material",
                    "occurrence_status": null,
                    "occurrence_class": "MachineObservation",
                    "catalog_number": "IB03_046.40",
                    "date_identified": null,
                    "other_catalog_numbers": "HQ730025-HQ730082",
                    "recorded_by": null,
                    "associated_sequences": [
                        {
                            "sequence_name": "IB03_046.40",
                            "MID": null,
                            "subspecf_gen_lin": "Bacteria",
                            "target_gene": "16S ssu rRNA",
                            "target_subfragment": null,
                            "type": null,
                            "primerName_forward": "BACT27F",
                            "primerName_reverse": "UNIV1391R",
                            "primer_forward": "AGAGTTTGATCCTGGCTCAG",
                            "primer_reverse": "GACGGGCRGTGWGTRCA",
                            "run_type": "Paired end sequencing with plasmid primers",
                            "seqData_url": null,
                            "seqData_accessionNumber": "HQ730025-HQ730082",
                            "seqData_projectNumber": "Marine bacterioplankton community structure in the vicinity of Antarctic icebergs",
                            "seqData_runNumber": null,
                            "seqData_sampleNumber": "HQ730025-HQ730082",
                            "seqData_numberOfBases": null,
                            "seqData_numberOfSequences": null
                        }
                    ]
                }
            ],
            "environment": [
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "samplingProtocol",
                    "env_method": null,
                    "env_units": "alphanumeric",
                    "env_numeric_value": null,
                    "env_text_value": "CTD Rosette/Niskin bottle"
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "dapi_stained_cells",
                    "env_method": null,
                    "env_units": "alphanumeric",
                    "env_numeric_value": "433000.00000",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "leucine_incorporation",
                    "env_method": null,
                    "env_units": "alphanumeric",
                    "env_numeric_value": "3.97466",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "par",
                    "env_method": null,
                    "env_units": "alphanumeric",
                    "env_numeric_value": null,
                    "env_text_value": "1.00E-12"
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "temp",
                    "env_method": null,
                    "env_units": "degrees Celcius",
                    "env_numeric_value": "0.35830",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "silicate",
                    "env_method": null,
                    "env_units": "micro Mol",
                    "env_numeric_value": "54.81000",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "salinity",
                    "env_method": null,
                    "env_units": "PSU",
                    "env_numeric_value": "33.97250",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "phosphate",
                    "env_method": null,
                    "env_units": "micro Mol",
                    "env_numeric_value": "1.72900",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "oxy_stat_samp",
                    "env_method": null,
                    "env_units": "Alphanumeric",
                    "env_numeric_value": null,
                    "env_text_value": "aerobic"
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "nitrite",
                    "env_method": null,
                    "env_units": "micro Mol",
                    "env_numeric_value": "0.19870",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "nitrate",
                    "env_method": null,
                    "env_units": "micro Mol",
                    "env_numeric_value": "25.50130",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "diss_oxygen",
                    "env_method": null,
                    "env_units": "mili liter per liter",
                    "env_numeric_value": "7.53428",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "ammonium",
                    "env_method": null,
                    "env_units": "micro Mol",
                    "env_numeric_value": "1.01900",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "aminopept_act",
                    "env_method": null,
                    "env_units": "nano Mol per day",
                    "env_numeric_value": "10.70000",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "alt",
                    "env_method": null,
                    "env_units": "meter",
                    "env_numeric_value": "0.00000",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "density",
                    "env_method": null,
                    "env_units": "kilogram per cubic meyer",
                    "env_numeric_value": "27.25770",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "samp_size",
                    "env_method": null,
                    "env_units": "liter",
                    "env_numeric_value": "2.00000",
                    "env_text_value": null
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "biotic_relationship",
                    "env_method": null,
                    "env_units": "Alphanumeric",
                    "env_numeric_value": null,
                    "env_text_value": "free living"
                },
                {
                    "env_sample_name": "IB03_046.40",
                    "created_at": "2020-12-17",
                    "link_climate_info": null,
                    "env_variable": "depth",
                    "env_method": null,
                    "env_units": "meter",
                    "env_numeric_value": "40.00000",
                    "env_text_value": null
                }
            ],
            "metadata_exists": true,
            "occurrence_exists": true,
            "environment_exists": true
        }
    ]
}